Search results for " truffle"
showing 9 items of 9 documents
Wild and cultivated mushrooms as a model of sustainable development
2013
The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…
IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA
2015
Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…
Macrofungi as ecosystem resources: Conservation versus exploitation
2013
Fungi are organisms of significant importance not only for the crucial roles they undertake in nature but also for many human activities that are strictly dependent on them. Indeed, fungi possess fundamental positions in ecosystems functioning including nutrient cycles and wood decomposition. As concerns human-related activities, edible and non-edible mushrooms are also involved and/or exploited in forestry, pharmaceutical industry and food production; hence, nowadays they represent a major economic source worldwide. In order to maintain and improve their strategic importance, several conservation strategies, such as habitat preservation, are needed. This article reports several contributio…
Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens
2015
The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …
New distributive and ecological data on Tuber magnatum (Tuberaceae) in Italy
2014
The recent discovery of natural truffle grounds of the prized Tuber magnatum Pico in Sicily (southern Italy) allows to up-to-date the ecology and distribution of this choice edible mushroom in Italy and opens new economic opportunities in rural areas traditionally suffering from the economic point of view. The two new localities reported expand the southern range border of the species in Italy and Europe.
New antimicrobial peptides from Tirmania pinoyi and Terfezia boudieri in the struggle against antibiotic resistance
2017
Antibiotic resistance of common pathogenic microorganisms is a topic of great concern that has finally received media attention and entered into the political agenda of world leaders. Drug-resistant bacteria are cause of thousands of deaths worldwide, then there is an urgent need for new antimicrobials, otherwise we risk losing the ability to control effectively the infectious diseases. Such emergence can be faced looking also at not usual source of antimicrobial agents, for example medicinal mushrooms. With the objective to tackle Gram-positive and Gram-negative pathogens, we focused on two edible desert truffles mushrooms Tirmania pinoyi and Terfezia boudieri as origin of new antimicrobia…
Antibacterial Activity of Desert Truffles from Saudi Arabia Against Staphylococcus aureus and Pseudomonas aeruginosa
2017
Abstract Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial, and immune-stimulating properties. Traditional studies of epigeous higher Basidiomycetes have recently been joined by studies of hypogeous fungi and, in particular, of so-called desert truffles. With the aim to obtain novel agents against bacteria of clinical importance, we focused on the edible desert truffle mushrooms Tirmania pinoyi, Terfezia claveryi, and Picoa juniperi as sources of new antimicrobial agents. In particular, we investigated the in vitro antibacterial activity of acid-soluble protein extracts (aqueous extracts) of these 3 species against the Gram-pos…
Characterization of key aroma compounds in Burgundy truffle
2021
International audience
Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…
2017
Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…